|
| << vorige | volgende >> |
Tijdschrift beschrijving
Alle jaargangen van het bijbehorende tijdschrift
Alle afleveringen van het bijbehorende jaargang
Alle artikelen van de bijbehorende aflevering
Details van artikel 10 van 11 gevonden artikelen
| Titel: |
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK |
| Auteur: |
Edith Burbano Sara Sierra Kirvis Torres Marcela Mercado Ana Carrascal Raúl Poutou |
| Verschenen in: |
Revista MVZ Córdoba |
| Paginering: | Jaargang 11 (2006) nr. 1 pagina's 715-724 |
| Jaar: |
2006 |
| Inhoud: |
Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA)and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method) provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses |
| Uitgever: |
Universidad de Cordoba |
| Bronbestand: |
Elektronische Wetenschappelijke Tijdschriften |
Details van artikel 10 van 11 gevonden artikelen
| << vorige | volgende >> |